Sensitive and specific detection of toxoplasma DNA in an experimental murine model: Use of Toxoplasma gondii-specific cDNA and the polvmerase chain reaction

Toxoplasma gondii, an apicomplexan parasite of mammals and birds, is well recognized as a cause of encephalitis in AIDS patients and as a cause of congenital infections. The polymerase chain reaction (PCR) and toxoplasma cDNA clones were used to diagnose T. gondii infection in an acute murine model of toxoplasmosis. Diagnosis of tissue infection by Southern blot hybridization with cDNA clones of T. gondii was possible within 5 days of infection. This technique could detect as few as 10,000 organisms. Specific T. gondii gene amplification by PCR using the primers 5′CACACGGTTGTATGTCGGTTTCGC3′and 5′TCAAGGAGCTCAATGTTACAGCC3′ followed by oligonucleotide hybridization using 5′GCGGTCATTCTCACACCGACGGAGAACCA-CTTCACTCTCA3′ allowed detection of T. gondii in the tissue of mice by day 2 after infection and in the blood of mice by day 5 after infection with RH strain T. gondii. This technique could detect as few as 10 organisms. Thus, these techniques may be useful in the diagnosis of toxoplasmosis.