Author Correction: HIV-1 diversity considerations in the application of the Intact Proviral DNA Assay (IPDA) (Nature Communications, (2021), 12, 1, (165), 10.1038/s41467-020-20442-3)

Natalie N. Kinloch, Yanqin Ren, Winiffer D.Conce Alberto, Winnie Dong, Pragya Khadka, Szu Han Huang, Talia M. Mota, Andrew Wilson, Aniqa Shahid, Don Kirkby, Marianne Harris, Colin Kovacs, Erika Benko, Mario A. Ostrowski, Perla M. Del Rio Estrada, Avery Wimpelberg, Christopher Cannon, W. David Hardy, Lynsay MacLaren, Harris GoldsteinChanson J. Brumme, Guinevere Q. Lee, Rebecca M. Lynch, Zabrina L. Brumme, R. Brad Jones

Research output: Contribution to journalComment/debatepeer-review

1 Scopus citations


The original version of this Article contained an error for the ‘RPP30-Shear Forward Primer sequence’ provided in the ‘Intact Proviral DNA Assay (IPDA)’ section of the Methods, which incorrectly read ‘CCAATTTGCTGCTCCTTGGG’. The correct sequence of the ‘RPP30-Shear Forward Primer’ is ‘CCATTTGCTGCTCCTTGGG’. This has been corrected in both the PDF and HTML versions of the Article.

Original languageEnglish (US)
Article number2958
JournalNature communications
Issue number1
StatePublished - Dec 2021

ASJC Scopus subject areas

  • Chemistry(all)
  • Biochemistry, Genetics and Molecular Biology(all)
  • Physics and Astronomy(all)


Dive into the research topics of 'Author Correction: HIV-1 diversity considerations in the application of the Intact Proviral DNA Assay (IPDA) (Nature Communications, (2021), 12, 1, (165), 10.1038/s41467-020-20442-3)'. Together they form a unique fingerprint.

Cite this